5 sept. 2013

hay que hacerle bullying, ¡bullying al athos! first part

no os dejéis engañar por el título de este post. en realidad, es él quien nos hace bullying.

athos, edad: 1 mes tres días de nacido cuando llegó a casa

a mi madre no le gustaban los perros, ni ningún otro animal como mascota en casa, pero, ¡oh!, ironías del destino. la foto más antigua que tengo de ella es de cuando tenía dieciocho años y estaba parada frente al gran portón de su casa, y, ¿adivinen qué? junto a ella estaba su gran pastor alemán llamado capitán.

muchos perros pasaron bajo el puente (es un decir) por las diferentes casas que alquilaban, compraban y vendían cada vez que se mudaban a una nueva casa. me refiero claro está, cuando mis padres ya estaban casados, y en el piso donde nací, el primer perro que vi cruzar por el umbral de la puerta lo trajo mi padre.

-iba caminando y se me pegó. me ha acompañado por varias cuadras hasta aquí. -fueron sus no tan exactas palabras.

duque, que así lo nombró mi padre, era un perro de tamaño mediano y de color mostaza, pero no tan oscuro como se pudiera pensar. era dócil y tranquilo. mi padre lo sacaba por la noche para hacer sus necesidades y luego lo subía para que duerma en la sala.
una vez que llegué del colegio, vi a duque tirado en la sala y con una de sus patas delanteras vendadas. me dijeron que un coche lo había atropellado y que mi padre fungiendo de veterinario le entablilló la pierna lastimada. no contento con eso se la vendó con un trapo blanco empapado con queroseno.
yo era un niño y las cosas que hacía mi padre no las cuestionaba. todo lo que él hacía estaba de lo más bien para mí. pero si hubiese tenido mucho más años y visto hacer aquello a mi padre, le hubiese dicho mientras prendía un encendedor:

-¿y ahora qué sigue? ¿le prendemos fuego? -no, si la filosofía de los locos adams es toda una inspiración para cualquiera.

una tarde, mi padre salió como siempre seguido de duque y en un momento de descuido, un edil pasó y le embadurnó bocado por todo el hocico. mi padre justo lo vio terminando la operación y lo recriminó. el hombre, conocía a mi padre y se lamentó muchísimo por lo que acababa de hacer. él pensó que duque era un perro callejero pues no tenía ni collar ni cadena (¿para qué?, si nunca lo necesitó ya que él llegó a nuestra casa como perro adulto y cuando salía jamás se despegaba de mi padre.) y entonces, trató de limpiar como pudo el hocico de duque, pero fue demasiado tarde. él ya había tragado bocado y murió poco después.

pasó el tiempo y me recuerdo a mí mismo con un perrito en brazos, escondiéndolo de mi madre para que no lo viera, ya que quería quedármelo, pero mi madre nos halló y dijo que no. que el piso donde vivíamos (90 metros cuadrados) no tenía el espacio suficiente para tener perros. y en verdad que tenía razón. así que el perro se fue por donde vino.

luego de unos años, nos mudamos a una casa más grande (180 metros cuadrados) con jardines interiores y exteriores incluidos. y si mi madre permitió que en la casa hayan perros fue debido a que nos dijo que se fueran al techo. allí estuvieron en diferentes épocas: laika, jazmín, templario y cerbero. ellos sólo abandonaban aquel lugar cuando salían a pasear a los diferentes parques de la zona pues, vivían y dormían allí.

recuerdo mucho al último de ellos. una vez entré de improviso al cuarto de la segunda de mis hermanas y la vi con un pequeño cocker spaniel de color negro acaramelado dentro de una caja de zapatos. cogí al perrito y mientras lo alzaba dije: "hola cerbero, ¿qué hay?".
contó mucho tiempo después la inocente de mi hermana, que se alegró sobremanera cuando me fui y que se decía a sí misma:

-le ha gustado el perrito y le ha puesto un bonito nombre: cerbero, mi cerberito.

la verdad es que el verdadero significado del nombre lo supo cuando le colocaron la vacuna antirrábica y el enfermero le preguntó cómo se llamaba el perrito para anotarlo en el registro.

aun así, el perro se quedó con tal nombre y vivió en el techo de la casa por más de una década hasta que murió justo en una reunión familiar debido al día de la madre. huelga decir que mis sobrinas presentes lloraron mucho, pues querían a cerbero, ya que jugaban con él cada vez que podían.

después de cerbero siguió dormilón, un perro de tamaño mediano que nos acompañó por ocho años. dormilón tenía una peculiaridad al momento de ladrar. él resoplaba antes de ladrar como si necesitara tomar impulso para hacerlo.

-buff... buff... buff... ¡guauguauguauguauguauguauguauguauguau!

y justamente así fue llamado el nuevo perro (luego de la muerte de dormilón): buff. un labrador que duró poco tiempo debido a que sufría de sarna y tuvo que ser sacrificado.

como mi madre ya había fallecido, dormilón ya no vivió en el techo como los perros que le precedieron. él a veces se acostaba por breves momentos en la cama donde mi padre estaba recluido sin levantarse debido al cáncer del pulmón que padecía.

aquel fue un feo año. dormilón murió el 5 de septiembre y mi padre unos meses después, el 11 de diciembre del 2003.

como ya dije anteriormente, el perro que reemplazó a dormilón fue buff, que sufría de sarna. buff era bien buena gente y muy tranquilo, pero debido a su mal estuvo muy pocos meses junto a nosotros. cuando se lo llevaron al veterinario yo intuía que ya no iba a regresar, y me despedí de él en silencio acariciándole la cabeza antes de que subiera al coche que se lo llevaría para no verlo más.

11 comentarios:

  1. ¡Awww que tristeza! Cuando las mascotitas se nos mueren.

    Nosotros sólo tuvimos a Rusty al que sacrificaron porque ya no podía caminar. Entonces un vecino quiso ayudar a sacrificarlo y lo iba a hacer con una pistola -nosotros éramos unos niños- y estábamos muy asustados. Recuerdo que el tipo subió a la azotea mientras nosotros llorábamos. Al poco rato bajó sin poder haber hecho nada porque dijo que Rusty lo vio de tal manera que no pudo disparar. Entonces llamaron al veterinario y lo inyectó para que muriera. Recuerdo que lo enterraron al pie de la escalera en el patio.

    Luego tuvimos a Dandy quien se hizo viejo con nosotros atado a una cadena ¡pobtrecito!
    Hoy no concibo un perro encadenado, ¡qué horror!

    Me has hecho recordar a mis mascotas infantiles DRACO.

    Un abrazo

    ResponderEliminar
    Respuestas
    1. al final, uno siente que no le dio a la mascota todo lo que tendría que haberle dado por su desinteresada compañía.

      un abrazo.

      Eliminar
  2. CREO QUE LO PEOR DE TODO ES CUANDO MUEREN O LOS TENEMOS QUE DEJAR EN LA VETERINARIA PARA QUE LO SACRIFIQUEN. NO VOY A OLVIDAR SUS OJITOS MIRÁNDOME Y DICIÉNDONOS ADIOS.
    SALUDOS

    ResponderEliminar
    Respuestas
    1. sí, ése es el momento más triste en la coexistencia con una mascota. yo aun no puedo comprender a aquellos que los dejan abandonados en la carretera o que los sacrifican porque les molestan mucho.
      saludos.

      Eliminar
  3. Durante mi infancia en mi casa sólo hubo un par de pajaritos, canarios. Pero se encargaba de ellos mi padre, yo ni me acordaba que existían.

    Ahora tengo una gata que por cierto vive mejor que yo, la muy perra. Pero me encanta.

    ResponderEliminar
    Respuestas
    1. pienso, que darle un poco más de las comodidades que se le puede dar a una mascota, es uno de los pocos engreimientos sanos que puede haber.

      saludos.

      Eliminar
  4. Ay por Dios, tengo el corazón arrugadito... me dejaste con un nudo en la garganta increíble. Por qué tienen que vivir tan poco tiempo (en comparación a los hombres) los perritos, son los mejores amigos de verdad. A ellos no les importa si uno es flaco o gordo, alto o bajo, simplemente te dan todo su amor.

    Mi Jerry vivió 10 años y le dio cáncer, mi papá tuvo que llevarlo con mi mamá al veterinario y se fue abrazado a ellos. Se me parte el alma de pensar que mi Bruno ya tiene 10 años, él es mi vida entera.

    Un beso grande Draco...
    El que ama a los animales tiene un gran corazón...

    ResponderEliminar
    Respuestas
    1. cuando murió el segundo perro al que le puse buff por nombre, fue justo esa idea que se instaló en mi mente:

      "que los perritos no deberían morirse nunca"

      un beso.

      Eliminar
    2. Me rompe el corazón de verdad :(

      Eliminar
  5. también tuve una perrita, pequeñaja y ratonera, y me dio tanta pena cuando murió que no he tenido más animales domésticos. Reconozco que a veces echo de menos ese tipo de compañía, pero no quiero recordar más muertes de las imprescindibles

    besos,

    ResponderEliminar
    Respuestas
    1. sí, te comprendo. es la parte más fea de la crianza de una mascota.

      besos.

      Eliminar

Y tú ¿qué opinas?